sgRNA (Single guide RNA) has two parts, crRNA (20 bp CRISPR RNAs) and tracrRNA (84 bp trans-activating crRNA):

1- Go to http://chopchop.cbu.uib.no/ and design a crRNA

2- For example for AHR for Exon 1 is:

TCACCTACGCCAGTCGCAAGCGG

Change first nucleotide to G and remove CGG (PAM sequence) at the end:

  • GCACCTACGCCAGTCGCAAG

3- Put it between these arms on left and right to have this oligo:

CGAGAAAAGCCTTGTTTGCACCTACGCCAGTCGCAAGGTTTTAGAGCTAA

Then, make a reverse complement of it and put it between these arms at left and right:

CCGGTTAGCTCTAAAACCTTGCGACTGGCGTAGGTGCAAACAAGGCTTTTCTCGCATG

4- Order these two oligos and anneal them.

CGAGAAAAGCCTTGTTTGCACCTACGCCAGTCGCAAGGTTTTAGAGCTAA

CCGGTTAGCTCTAAAACCTTGCGACTGGCGTAGGTGCAAACAAGGCTTTTCTCGCATG

 

5- Annealing two ordered oligos (after annealing, the dsDNA has already cohesive ends for SphI and AgeI):

Clone the oligos: I put 1 ug of each oligo in 10 ul of 1X T4 ligase buffer (there is ATP already in this buffer so I don’t have to use the T4 PNK buffer and supplement ATP). Then, I add 3 ul of T4 PNK, incubate 30 min at 37C to kinase the oligos. Then I put the oligos at 95C for 2 minutes to denature the enzyme and any annealed oligos and I let the oligos cool down in a heating block until it reaches room temperature. Then, the oligos should be annealed.

6- Digest plasmid with SphI and AgeI. Now dephosphorylate the linearized plasmid with Antarctic Phosphatase. Deactivate it, run it on gel and extract and purify it.

CRISPR plasmid

7- Mix annealed-fragment from step 5 with linearized-plasmid from step6 and ligate them by T4-ligase.

Then I take 1 ul of the annealed oligos (200 ng total) and I mix with 200 ng of cut, dephosphorylated and gel-purified vector with 1 ul of T4 DNA ligase in 20 ul of 1X T4 DNA ligase buffer. I ligate overnight at room temperature and transform bacteria the next day. You can play with the oligos/Vector ratio if the yield is not great.

8- Transform competent bacteria.

9- Plasmid purification and sequencing for verification.

10- Transfecting HEK293 cells to verify the efficiency of gRNA to knockout the gene.

11- To verify the knockout the gene in 293 cells we use:

 

“T7 Endonuclease I cleavage assay”

The method is pretty straightforward and consists of 4 parts: DNA isolation, PCR of desired locus, denaturation and re-annealing, and T7 endonuclease I cleavage.

*****************

* DNA isolation *

*****************

Use your favorite protocol, or the quick ‘n’ dirty method below

HotSHOT lysis

  1. Trypsinize cells from a well of a 24-well or 12-well microfuge tube. Collect in an Eppendorf, spin out the supernatant. You don’t need a lot of cells, eyeball maybe 10-20 ul cell pellet at most for efficient lysis
  2. Add 75-100 µl Alkaline Lysis Reagent. Assure that the cell pellet is completely submerged.
  3. Incubate at 95°C for 30-60 min.
  4. Add 75-100 µl Neutralization Reagent using a new aerosol-barrier tip for each sample. Mix well, using tip to break up tissue. Some people like to centrifuge the tubes after this step and transfer the neutralized supernatant to a new tube, but this is not necessary.
  5. Use 2-3 µl of neutralized supernatant per 20-25 µl PCR reaction, more and you might start to inhibit the PCR reaction (usually the case for mouse.

 

Alkaline Lysis Reagent:

To 25 ml water, add:

62.5 µl of 10 N NaOH (final concentration is 25 mM.)

10.0 µl of 0.5 M disodium EDTA (final concentration is 0.2 mM, pH should be about 12 but should not have to be adjusted.)

Make fresh every one to two months. Keep solution at room temperature.

Neutralization Reagent

40 mM Tris-HCl pH should be about 5 but should not have to be adjusted.)

Keep solution at room temperature.

Make 1 M Tris-HCl with Tris hydrochloride salt (not the base).

****************

* PCR reaction *

****************

You preferably want to use a high-fidelity polymerase with hotstart characteristics. I used Q5 hotstart from NEB because it is cheap and robust. Design primers of your targeted locus using Primer-BLAST; set the desired target size to be between 200-1000 bp and 300 bp offset from the sgRNA, %GC-content 40-60%, melting temperature optimum at 60, oligo size 18-25 nt in length.

Protocol that I followed:

Component 25 µl Reaction

5X Q5 Reaction Buffer 5 µl

10 mM dNTPs 0.5 µl

10 µM Forward Primer 1.25 µl

10 µM Reverse Primer 1.25 µl

Template DNA 2 µl

Q5 Hot Start 0.25 µl

Nuclease-Free Water to 25 µl

You might need to add GC-enhancer if the region that you are PCRing up is especially GC-rich or has a GC-rich stretch of nucleotides.

Thermocycling Conditions for a Routine PCR

STEP TEMP TIME

Initial Denaturation 98°C 30 seconds

25–35 Cycles 98°C 10 seconds

*50–72°C 30 seconds

72°C 30 seconds/kb

Final Extension 72°C 2 minutes

Hold 10°C

Use the NEB calculator to calculate the annealing temperature for your oligos. If it calculates your oligos for use at 72°C, do a 2-step reaction, but extend the 72°C to 60 seconds.

I do several reactions to achieve enough substrate for the assay — 3-4 reactions generally will yield a nice quantity. You will need at least ~200 ng per reaction. Load a couple of µl from a reaction on a gel to make sure that you have a single band (also load your negative reaction to make sure that you have no contamination). I purify using a spin column and elute in 50 µl of warm (60°C) elution buffer. This will typically yield ~20-30 ng/µl of product.

****************

* Re-annealing *

****************

Add ~200-500 ng of product to a 20 µl reaction of H2O and (2 µl) 1X NEB Buffer 2. You will need 2 tubes per reaction, one for the nuclease and one for a negative (non-nuclease) control. Denature and re-anneal in a PCR machine using the parameters below:

Temperature Time

95 °C 10 min

95 °C to 85 °C (‐2.0 °C/s)

85 °C 1 min

85 °C to 75 °C (‐0.3 °C/s)

75 °C 1 min

75 °C to 65 °C (‐0.3 °C/s)

65 °C 1 min

65 °C to 55 °C (‐0.3 °C/s)

55 °C 1 min

55 °C to 45 °C (‐0.3 °C/s)

45 °C 1 min

45 °C to 35 °C (‐0.3 °C/s)

35 °C 1 min

35 °C to 25 °C (‐0.3 °C/s)

25 °C 1 min

10 °C Hold ∞

On our machine ‐2.0 °C/s is a 50% ramp rate and a ‐0.3 °C/s is a 2% ramp rate.

************************************

* T7 Endonuclease I cleavage assay *

************************************

To each tube, add 1 µl of T7 endonuclease I (10 U). Incubate at 37°C for 15 min. Stop the reaction by the adding 2 µl of 0.5 M EDTA. Load half (or more) on a 2% TBE or 1.5% SB agarose gel. Staining afterword will give a cleaner signal-noise, in which case wait until the orange dye is near the bottom of the gel (and the cyan dye is about 1/3-1/2 the way down) before you stop and stain the gel (0.5 ug/ml of EtBr for 15 min, rinse in H2O, de-stain 15 min in H2O).

Or use

“IDT Surveyor Mutation Detection Kits”

12- If we observed a mutation in step 11, we transfect new HEK293cells with packaging plasmids (psPAX2 and pMD2.G) plus the plasmid made above.

13- Transduce the target cells with the virus produced in HEK293 cells.

14- Sort the cells in 96 well plate, based on the GFP expression.

15- Grow the cells and verify the knockout in each clone by western blot and sequencing.

 

 

Advertisements