Regulated Cell Death 13 pathways explained

Leave a comment

https://www.bio-rad-antibodies.com/regulated-cell-death-antibodies-kits.html

Advertisements

Protein domains/Linker

Leave a comment

http://parts.igem.org/Protein_domains/Linker

http://www.ibi.vu.nl/programs/linkerdbwww/

http://zeus.few.vu.nl/jobs/9f39deb0b0e963de3761b896c57ad613/

 

a copy paste of first link, just in case:

Protein domains/Linker:

Linkers are short peptide sequences that occur between protein domains. Linkers are often composed of flexible residues like glycine and serine so that the adjacent protein domains are free to move relative to one another. Longer linkers are used when it is necessary to ensure that two adjacent domains do not sterically interfere with one another.

More…
Name Description AA sequence Length
BBa_J176131 PLrigid 60
BBa_J18920 2aa GS linker 6
BBa_J18921 6aa [GS]x linker 18
BBa_J18922 10aa [GS]x linker 30
BBa_K105012 10 aa flexible protein domain linker 30
BBa_K133132 8 aa protein domain linker 24
BBa_K1486003 Flexible linker 2x (GGGS) 24
BBa_K1486004 flexible linker 2x (GGGGS) 30
BBa_K1486037 13 amino acids linker [GGGS GGGGS GGGS] 39
BBa_K1486053 10 aa linker 30
BBa_K157009 Split fluorophore linker; Freiburg standard 51
BBa_K157013 15 aa flexible glycine-serine protein domain linker; Freiburg standard 45
BBa_K1680001 protein linker, 9aa 15
BBa_K1680002 Protein linker, 12aa 24
BBa_K1680003 Protein linker, 15 amino acids 33
BBa_K1777005 flexible linker with SV40 NLS 124
BBa_K1777019 flexible linker 36
BBa_K2382004 Thioredoxin with polylinker 384
BBa_K2429126 Glycine-Serine Linker 24
BBa_K243004 Short Linker (Gly-Gly-Ser-Gly) 12
BBa_K243005 Middle Linker ( Gly-Gly-Ser-Gly)x2 24
BBa_K243006 Long Linker (Gly-Gly-Ser-Gly)x3 36
BBa_K243029 GSAT Linker 108
BBa_K243030 SEG 108
BBa_K2549045 linker between GAL4 DNA binding domain and VP64 transcription activator 36
BBa_K2549053 G4S linker 15
BBa_K2812004 Coding sequence for trunctated Lysostaphin fused to His-tagged HlyA 1458
BBa_K2812005 Coding sequence for trunctated Lysostaphin with HlyA and His6-tag regulated by T7-promoter 1496
BBa_K2812006 Coding sequence for Pyocin S5 with HlyA and His6-tag 2217
BBa_K2812007 Coding sequence for Pyocin S5 with HlyA and His6-tag regulated by pBAD-ara promoter 2288
BBa_K404300 SEG-Linker 108
BBa_K404301 GSAT-Linker 108
BBa_K404303 Z-EGFR-1907_Short-Linker 192
BBa_K404304 Z-EGFR-1907_Middle-Linker 204
BBa_K404305 Z-EGFR-1907_Long-Linker 216
BBa_K404306 Z-EGFR-1907_SEG-Linker 288
BBa_K416001 (Gly4Ser)3 Flexible Peptide Linker 45
BBa_K648005 Short Fusion Protein Linker: GGSG with standard 25 prefix/suffix 12
BBa_K648006 Long 10AA Fusion Protein Linker with Standard 25 Prefix/Suffix 30
BBa_K648007 Medium 6AA Fusion Protein Linker: GGSGGS with Standard 25 Prefix/Suffix 18

CRISPR protocol

Leave a comment

sgRNA (Single guide RNA) has two parts, crRNA (20 bp CRISPR RNAs) and tracrRNA (84 bp trans-activating crRNA):

1- Go to http://chopchop.cbu.uib.no/ and design a crRNA

2- For example for AHR for Exon 1 is:

TCACCTACGCCAGTCGCAAGCGG

Change first nucleotide to G and remove CGG (PAM sequence) at the end:

  • GCACCTACGCCAGTCGCAAG

3- Put it between these arms on left and right to have this oligo:

CGAGAAAAGCCTTGTTTGCACCTACGCCAGTCGCAAGGTTTTAGAGCTAA

Then, make a reverse complement of it and put it between these arms at left and right:

CCGGTTAGCTCTAAAACCTTGCGACTGGCGTAGGTGCAAACAAGGCTTTTCTCGCATG

4- Order these two oligos and anneal them.

CGAGAAAAGCCTTGTTTGCACCTACGCCAGTCGCAAGGTTTTAGAGCTAA

CCGGTTAGCTCTAAAACCTTGCGACTGGCGTAGGTGCAAACAAGGCTTTTCTCGCATG

 

5- Annealing two ordered oligos (after annealing, the dsDNA has already cohesive ends for SphI and AgeI):

Clone the oligos: I put 1 ug of each oligo in 100 ul of 1X T4 ligase buffer (there is ATP already in this buffer so I don’t have to use the T4 PNK buffer and supplement ATP). Then, I add 3 ul of T4 PNK, incubate 30 min at 37C to kinase the oligos. Then I put the oligos at 95C for 2 minutes to denature the enzyme and any annealed oligos and I let the oligos cool down in a heating block until it reaches room temperature. Then, the oligos should be annealed.

Then I take 1 ul of the annealed oligos (200 ng total) and I mix with 200 ng of cut, dephosphorylated and gel-purified vector with 1 ul of T4 DNA ligase in 20 ul of 1X T4 DNA ligase buffer. I ligate overnight at room temperature and transform bacteria the next day. You can play with the oligos/Vector ratio if the yield is not great.

6- Digest plasmid with SphI and AgeI.

CRISPR plasmid

7- Mix annealed-fragment from step 5 with linearized-plasmid from step6 and ligate them by T4-ligase.

8- Transform competent bacteria.

9- Plasmid purification and sequencing for verification.

10- Transfecting HEK293 cells to verify the efficiency of gRNA to knockout the gene.

11- To verify the knockout the gene in 293 cells we use:

 

“T7 Endonuclease I cleavage assay”

The method is pretty straightforward and consists of 4 parts: DNA isolation, PCR of desired locus, denaturation and re-annealing, and T7 endonuclease I cleavage.

*****************

* DNA isolation *

*****************

Use your favorite protocol, or the quick ‘n’ dirty method below

HotSHOT lysis

  1. Trypsinize cells from a well of a 24-well or 12-well microfuge tube. Collect in an Eppendorf, spin out the supernatant. You don’t need a lot of cells, eyeball maybe 10-20 ul cell pellet at most for efficient lysis
  2. Add 75-100 µl Alkaline Lysis Reagent. Assure that the cell pellet is completely submerged.
  3. Incubate at 95°C for 30-60 min.
  4. Add 75-100 µl Neutralization Reagent using a new aerosol-barrier tip for each sample. Mix well, using tip to break up tissue. Some people like to centrifuge the tubes after this step and transfer the neutralized supernatant to a new tube, but this is not necessary.
  5. Use 2-3 µl of neutralized supernatant per 20-25 µl PCR reaction, more and you might start to inhibit the PCR reaction (usually the case for mouse.

 

Alkaline Lysis Reagent:

To 25 ml water, add:

62.5 µl of 10 N NaOH (final concentration is 25 mM.)

10.0 µl of 0.5 M disodium EDTA (final concentration is 0.2 mM, pH should be about 12 but should not have to be adjusted.)

Make fresh every one to two months. Keep solution at room temperature.

Neutralization Reagent

40 mM Tris-HCl pH should be about 5 but should not have to be adjusted.)

Keep solution at room temperature.

Make 1 M Tris-HCl with Tris hydrochloride salt (not the base).

****************

* PCR reaction *

****************

You preferably want to use a high-fidelity polymerase with hotstart characteristics. I used Q5 hotstart from NEB because it is cheap and robust. Design primers of your targeted locus using Primer-BLAST; set the desired target size to be between 200-1000 bp and 300 bp offset from the sgRNA, %GC-content 40-60%, melting temperature optimum at 60, oligo size 18-25 nt in length.

Protocol that I followed:

Component 25 µl Reaction

5X Q5 Reaction Buffer 5 µl

10 mM dNTPs 0.5 µl

10 µM Forward Primer 1.25 µl

10 µM Reverse Primer 1.25 µl

Template DNA 2 µl

Q5 Hot Start 0.25 µl

Nuclease-Free Water to 25 µl

You might need to add GC-enhancer if the region that you are PCRing up is especially GC-rich or has a GC-rich stretch of nucleotides.

Thermocycling Conditions for a Routine PCR

STEP TEMP TIME

Initial Denaturation 98°C 30 seconds

25–35 Cycles 98°C 10 seconds

*50–72°C 30 seconds

72°C 30 seconds/kb

Final Extension 72°C 2 minutes

Hold 10°C

Use the NEB calculator to calculate the annealing temperature for your oligos. If it calculates your oligos for use at 72°C, do a 2-step reaction, but extend the 72°C to 60 seconds.

I do several reactions to achieve enough substrate for the assay — 3-4 reactions generally will yield a nice quantity. You will need at least ~200 ng per reaction. Load a couple of µl from a reaction on a gel to make sure that you have a single band (also load your negative reaction to make sure that you have no contamination). I purify using a spin column and elute in 50 µl of warm (60°C) elution buffer. This will typically yield ~20-30 ng/µl of product.

****************

* Re-annealing *

****************

Add ~200-500 ng of product to a 20 µl reaction of H2O and (2 µl) 1X NEB Buffer 2. You will need 2 tubes per reaction, one for the nuclease and one for a negative (non-nuclease) control. Denature and re-anneal in a PCR machine using the parameters below:

Temperature Time

95 °C 10 min

95 °C to 85 °C (‐2.0 °C/s)

85 °C 1 min

85 °C to 75 °C (‐0.3 °C/s)

75 °C 1 min

75 °C to 65 °C (‐0.3 °C/s)

65 °C 1 min

65 °C to 55 °C (‐0.3 °C/s)

55 °C 1 min

55 °C to 45 °C (‐0.3 °C/s)

45 °C 1 min

45 °C to 35 °C (‐0.3 °C/s)

35 °C 1 min

35 °C to 25 °C (‐0.3 °C/s)

25 °C 1 min

10 °C Hold ∞

On our machine ‐2.0 °C/s is a 50% ramp rate and a ‐0.3 °C/s is a 2% ramp rate.

************************************

* T7 Endonuclease I cleavage assay *

************************************

To each tube, add 1 µl of T7 endonuclease I (10 U). Incubate at 37°C for 15 min. Stop the reaction by the adding 2 µl of 0.5 M EDTA. Load half (or more) on a 2% TBE or 1.5% SB agarose gel. Staining afterword will give a cleaner signal-noise, in which case wait until the orange dye is near the bottom of the gel (and the cyan dye is about 1/3-1/2 the way down) before you stop and stain the gel (0.5 ug/ml of EtBr for 15 min, rinse in H2O, de-stain 15 min in H2O).

Or use

“IDT Surveyor Mutation Detection Kits”

12- If we observed a mutation in step 11, we transfect new HEK293cells with packaging plasmids (psPAX2 and pMD2.G) plus the plasmid made above.

13- Transduce the target cells with the virus produced in HEK293 cells.

14- Sort the cells in 96 well plate, based on the GFP expression.

15- Grow the cells and verify the knockout in each clone by western blot and sequencing.

 

 

Experimental Overview of CRISPR Cas9 for Gene Knockout

Leave a comment

https://info.abmgood.com/crispr-crash-course-week-1

https://info.abmgood.com/crispr-crash-course-week-2

https://info.abmgood.com/crispr-crash-course-week-3

https://info.abmgood.com/crispr-crash-course-week-4

Adding a protein Tag by Cas9

Leave a comment

https://blog.addgene.org/hassle-free-96-well-format-epitope-tagging-using-cas9-ribonucleoprotein

http://tagin.stembio.org/submit/

http://crispr.mit.edu/

Alternative to ChIP; Methods for identify proteins occupying a specific genomic lucus

Leave a comment

C-BERST

https://blog.addgene.org/hot-plasmids-june-2018/#CBERST

https://www.nature.com/articles/s41592-018-0006-2

Caspex

https://blog.addgene.org/hot-plasmids-june-2018/#caspex

https://www.nature.com/articles/s41592-018-0007-1

Split-BioID: An Improved Method for Studying Protein-Protein Interactions

Leave a comment

https://blog.addgene.org/split-bioid-an-improved-method-for-studying-protein-protein-interactions

Older Entries