CRIPRE “prime editing

Leave a comment

The new technology uses an engineered protein that, according to a report by Liu and 10 others today in the journal Nature, can transform any single DNA letter into any other, as well as add or delete longer stretches. In fact, Liu claims it’s capable of repairing nearly any of the 75,000 known mutations that cause inherited disease in humans.

https://www.technologyreview.com/s/614599/the-newest-gene-editor-radically-improves-on-crispr/

https://www.nature.com/articles/s41586-019-1711-4

https://blog.addgene.org/prime-editing-crisp-cas-reverse-transcriptase

Free Tools for Making Scientific Graphics

Leave a comment

From:  https://blog.addgene.org/early-career-researcher-toolbox-free-tools-for-making-scientific-graphics

https://docs.google.com/drawings

https://vectr.com/

https://inkscape.org/

https://biorender.com/

https://smart.servier.com/

https://www.google.com/imghp?hl=en

 

How to Choose Membrane Protein Isolation Kits

Leave a comment

A copy paste from:

https://mailchi.mp/8a681e99aad0/tip-of-the-day-how-to-choose-plasma-membrane-isolation-kit?e=b635f2eed1

Plasma membrane (PM) proteins play a critical role in a variety of physiological and pathological processes.  Signal transduction, molecular transport and cell-cell interactions are all mediated by PM proteins. PM proteins include a variety of important proteins such as neurotransmitter receptors, G-proteins, carriers, voltage-gated ion channels, CD antigens and many drug targets. The detection, characterization, and intracellular trafficking of PM proteins are, therefore, essential for understanding of biological systems.

Isolation/purification is usually the first step for characterization and profiling of PM proteins.  However, it has been proven to be particularly challenging because of their low abundance and the nature of inter-connectivity of intracellular membrane systems. PM proteins are traditionally isolated by sucrose density ultra-centrifugation [1,2].  The protocol is tedious and time consuming and takes hours to even days to complete.  In recent years, more and more publications cited commercial kits for PM protein isolation and characterization due to their ease of use and speed.  However, different kits employee different mechanisms of action.  The efficacy of the kit varies significantly depending upon specific downstream applications.  Due to the availability of multiple PM protein isolation/purification kits in the market, it is, sometimes, difficult or even confusing for selection of a proper kit for a particular research project.  In this context, we attempt to summarize pro and cons of some of the commonly used membrane protein isolation kits and provide a general guide for selection of commercial membrane protein isolation kits.

Generally speaking, all commercially available membrane protein isolation kits can be classified into four basic categories according to their mechanisms of action or principles of isolation.

  1. Phase extraction.  Mem-PER™ Plus Membrane Protein Extraction Kit (Thermo Fisher), Mem-PER® Eukaryotic Membrane Protein Extraction Reagent Kit (Thermo Fisher) and ProteoExtract™ Native Membrane Protein Extraction Kit (Millipore-Sigma) are typical kits included in this class.  Cells/tissues are first lysed by lysis buffer, soluble proteins and insoluble fractions are separated by centrifugation.  Membrane proteins are further extracted from insoluble fraction by an extraction buffer based on hydrophobicity of membrane proteins.  These kits are relative simple and rapid (about 1h).  The protocol generates two distinctive portions: cytosolic fraction and membrane protein fraction however it is not clear from the protocol whether a detergent is used for cell lysis. Membrane proteins extracted are derived from all membrane systems such as mitochondria, ER, Golgi and nuclei.  What extracted by these kits are actually total membrane proteins. It can be anticipated that the membrane protein extraction may or may not be complete for certain samples especially for those proteins that transverse bio-membrane multiple times. It is not clear if membrane associated proteins remain bound and intact in the extracted membrane proteins.
  2. Cell surface labeling. Pierce cell surface protein isolation kit (Thermo Fisher) and Qproteomic Plasma membrane kit (Qiagen) belong to this class.  A typical experiment using pierce cell surface protein isolation kit involves labeling of cell surface proteins by sulfo-NHS-biotin.  After labeling, cells are lysed and the cell lysate is applied to an avidin-conjugated solid phase.  Biotinylated plasma membrane proteins are eluted using a denaturing elution buffer.  In theory, this approach should produce highly purified plasma membrane proteins. However, in reality, This method suffers many inherited disadvantages.  For example, not every protein on the cell surface will be labeled.  The protein profile of a given cell culture may change with cultured time and conditions.  Steric hindrance and lack of primary amines may interfere with protein labeling resulting in inconsistent results. The use of denatured elution solution also limits the application of isolated proteins.
  3. Phase partitioning. A typical example of this class is the Plasma Membrane Protein Extraction Kit from Biovision and Abcam. The mechanisms of action is similar to an earlier published aqueous two phase partitioning method [3].  The protocol takes the advantage of differential partitioning of plasma membrane in the upper phase and other membranes (such as ER, Golgi and mitochondria) in lower phase for enrichment and isolation of plasma membrane proteins. Cultured cells/tissue samples are first homogenized using a Dounce homogenizer.  The lysed samples are subject to multiple extraction and centrifugations resulting in total membrane protein, cytosolic and plasma membrane protein fractions.  The pros of the method are to be able to isolate detergent-free plasma membrane proteins and the protocol is relatively sample and rapid (about 1 -1.5 h).  However, large cell numbers are required (50-100 millions/sample) and the yield is relatively low (1-100ug/sample).  It was claimed by the manufacturer that the purity of plasma membrane protein is over 90% but no supporting data are shown.
  4. Spin column-based subcellular fractionation.  This is a next generation plasma membrane protein isolation technology from Invent biotechnologies featuring a simple and rapid method for subcellular fractionation without using a Dounce homogenizer.  Cells/tissues are passed through a specialized filter cartridge.  Plasma membranes of the cells are ruptured during the process and intact nuclei, organelles, plasma membrane, and cytosolic proteins are released into a suspension which is further separated into five fractions:  total membrane, plasma membrane, cytosolic, organellar, and nucleus fractions.  Due to the use of the filter cartridge and a unique buffer system, high yield of native plasma membrane protein can be obtained in less than one hour with minimum cross-contaminations.  The native plasma membrane protein isolated can be used for any downstream experiments. Unlike all other kits described above, the spin column-based plasma membrane isolation kit can also be used for plant PM protein isolation. This kit is becoming more and more popular as evidenced by the data from selected publications below.

The selection of a particular membrane protein isolation kit mainly depends on specific downstream applications. Some PM isolation kits have much broader applications than others.  For instance, detergent-free native PM proteins can be used for almost all possible downstream applications, while those isolated by Pierce cell surface protein isolation kit is only recommended for Western blotting.  Following examples illustrate what is expected from a good subcellular fractionation kit.  Many PM proteins are present in relatively low concentration.  Sometimes it is difficult to detect and quantify membrane proteins without isolation and enrichment.  Following data [4] clearly demonstrate the effect of PM protein enrichment on detectability of SGLT1 from human heart samples.  The SGLT and plasma membrane marker protein Na+/K+ ATPase signals are significantly enhanced in plasma membrane fraction as compared to total membrane fraction.

Kutluay et al. [5] studied the changes in Gag-RNA binding to viral RNA during HIV-1 virion assembly.  One of the key experiment is to demonstrate different form of Gag-RNA adducts present in different subcellular locations. 4SU-fed 293T cells were transfected with HIV-1 proviral plasmid and fractionated by spin column-based plasma membrane protein isolation kit. The cytosolic and plasma membrane fractions were subjected to Western blotting and immunoprecipitation.  The results indicate that the cytosolic Gag protein is primarily monomeric, while Gag protein on plasma membrane is multimerized (B). This conclusion heavily depends on clear separation of cytosolic and plasma membrane fractions (A). if significant cross-contamination is present, the conclusion would be questionable.

Studies of Intracellular target protein distribution and target protein trafficking under different experimental conditions and different treatment of experimental groups are important for biomedical research. The target protein can be tracked by subcellular fractionation followed by a specific detection method.  Leung et al. [6] studied the effect of PRL-3 on ULBP2 protein trafficking by cell fractionation.  Human colon cancer cell line HCT 116 was treated with 40 um RPL-3 and subjected to subcellular fractionation using a spin column-based plasma membrane isolation kit. The results showed a clear separation of PM, organelle and cytosolic fractions.  Treatment of the cell with the chemical results in translocation of plasma membrane to organelle fraction.  Again this conclusion is based on clear separation of difference subcellular fractions.

As demonstrated by Jose et al. [7], Spin-column PM isolation kit (SM-005, Invent Biotechnologies) can fractionate cultured endothelial cells into different subcellular fractions and most important of all, the isolated PM protein shows minimum/or no cross contamination from organelles such as mitochondria, ER and Golgi.

Degree of cross-contamination is obviously one of the most important factors for selection of a membrane protein isolation kit. The performance of commercial kits differs significantly with this criterion. Bunger et al. [8] compared five commercial membrane protein isolation kits for cross-contamination between cytosolic (Cyt) and plasma membrane (Mem) fractions and found that all kits tested show obvious cross-contamination for two commonly used markers (ATPase and GAPDH). The performance of the kits varies significantly when cadherin is used for a PM marker. It is highly recommended to choose a membrane protein isolation kit by referencing with high impact factor publications.

As a summary, membrane protein isolation kits are valuable tools for researchers.  Compared to traditional methods, a good commercial kit can save time. increase efficiency and speed up discovery process.  The selection of a particular kit should be mainly based on the performance and specific downstream experiments. Sample size required, sometimes, is an important factor to be considered especially when available cell number is a limiting factor. Under ideal conditions, a good commercial kit should provide researcher with expected results without significant trouble shooting and optimization.  Another criterion to be considered is to determine if the kit can give researchers a competitive edge in terms of ease of use, speed, performance and cost.

References:

  1. Neville, D. M, (1960) The isolation of a cell membrane fraction from rat liver.  J. Biophy. Biochem. Cyto. 8: 413-421.
  2. Touster, O. et al. (1970) Isolation of liver plasma membranes.  J. Cell Bio. 47:604-618.
  3. Yoshida, S. et al. (1983) Partitioning of membrane particles in aqueous two-polymer phase system and its practical use for purification of plasma membranes from plants.Plant physiol. 72:105-114.
  4. Kashiwagi Y. et al. (2015) Expression of SGLT1 in Human Hearts and Impairment of Cardiac Glucose Uptake by Phlorizin during Ischemia- Reperfusion Injury in Mice. PLoS ONE 10(6):e0130605.
  5. Kutluay, S., et al. (2014). Global Changes in the RNA Binding Specificity of HIV-1 Gag Regulate Virion Genesis, Cell (2014), http://dx.doi.org/10.1016/j.cell.2014.09.057
  6. Leung W-H. et al. (2015). PRL-3 Mediates the protein Maturation of ULBP2 by regulating the tyrosine phosphorylation of HSP60.The Journal of Immunology.doi:10.4049/jimmunol.1400817.
  7. VazquezMedina J.P. et al. (2016).  The phospholipase A2 activity of peroxiredoxin 6 modulates NADPH oxidase 2 activation vialysophosphatidic acid receptor signaling in the pulmonary endothelium and alveolar macrophages. The FASEB Journal. doi: 10.1096/fj.201500146R
  8. Bunger, S. et al. (2009) Comparison of five commercial extraction kits for subsequent membrane protein profiling.  Cytotechnology. 61:153-159.

protelytic cleavage of fusion tags

Leave a comment

Cleavage Tag Sequence & Cleavage Enzyme Name  Notes
3C (‘PreScission’) cleavage tag LEVLFQ/GP
(/ = main cleavage site)
Human Rhinovirus (HRV) 3C Protease HRV is a highly specific protease that cleaves between the Glu and Gly residues in the cleavage tag. It is often produced with the tradename ‘PreScission protease or PSP’.
EKT (Enterokinase) cleavage tag DDDDK/
(/ = main cleavage site)
Enterokinase Enterokinase is an intestinal enzyme normally involved in the protease cleavage of Trypsin. It cleaves after the Lysine (K) in is recognition sequence.
FXa (Factor Xa) cleavage tag IEGR/
(/ = main cleavage site)
Factor Xa Factor Xa cleaves after the Arg residue but can also cleave less frequently at secondary basic sites. Its most common secondary cleavage site is between the Gly and Arg residues in its own recognition site, although the frequency of these events is protein specific.
TEV (tobacco etch virus) cleavage tag ENLYFQ/G
(/ = main cleavage site)
Tobacco etch virus protease Cleavage occurs between the Glu and Gly residues. TEV is often reported to have better specificity for its recognition site compared to EKT, Thrombin or Factor Xa.
Thrombin cleavage tag LVPR/GS
(/ = main cleavage site)
Thrombin Thrombin cleaves preferentially between the Arg and Gly residues. Off target cleavage can occur at non-specific sites, normally from contaminating proteases. To ensure maximal protein integrity the enzyme reagent must be very pure.

https://www.oxfordgenetics.com/SiteContent/TeamResources/cleavage-tag-guide

Regulated Cell Death 13 pathways explained

Leave a comment

https://www.bio-rad-antibodies.com/regulated-cell-death-antibodies-kits.html

Protein domains/Linker

Leave a comment

http://parts.igem.org/Protein_domains/Linker

http://www.ibi.vu.nl/programs/linkerdbwww/

http://zeus.few.vu.nl/jobs/9f39deb0b0e963de3761b896c57ad613/

 

a copy paste of first link, just in case:

Protein domains/Linker:

Linkers are short peptide sequences that occur between protein domains. Linkers are often composed of flexible residues like glycine and serine so that the adjacent protein domains are free to move relative to one another. Longer linkers are used when it is necessary to ensure that two adjacent domains do not sterically interfere with one another.

More…
Name Description AA sequence Length
BBa_J176131 PLrigid 60
BBa_J18920 2aa GS linker 6
BBa_J18921 6aa [GS]x linker 18
BBa_J18922 10aa [GS]x linker 30
BBa_K105012 10 aa flexible protein domain linker 30
BBa_K133132 8 aa protein domain linker 24
BBa_K1486003 Flexible linker 2x (GGGS) 24
BBa_K1486004 flexible linker 2x (GGGGS) 30
BBa_K1486037 13 amino acids linker [GGGS GGGGS GGGS] 39
BBa_K1486053 10 aa linker 30
BBa_K157009 Split fluorophore linker; Freiburg standard 51
BBa_K157013 15 aa flexible glycine-serine protein domain linker; Freiburg standard 45
BBa_K1680001 protein linker, 9aa 15
BBa_K1680002 Protein linker, 12aa 24
BBa_K1680003 Protein linker, 15 amino acids 33
BBa_K1777005 flexible linker with SV40 NLS 124
BBa_K1777019 flexible linker 36
BBa_K2382004 Thioredoxin with polylinker 384
BBa_K2429126 Glycine-Serine Linker 24
BBa_K243004 Short Linker (Gly-Gly-Ser-Gly) 12
BBa_K243005 Middle Linker ( Gly-Gly-Ser-Gly)x2 24
BBa_K243006 Long Linker (Gly-Gly-Ser-Gly)x3 36
BBa_K243029 GSAT Linker 108
BBa_K243030 SEG 108
BBa_K2549045 linker between GAL4 DNA binding domain and VP64 transcription activator 36
BBa_K2549053 G4S linker 15
BBa_K2812004 Coding sequence for trunctated Lysostaphin fused to His-tagged HlyA 1458
BBa_K2812005 Coding sequence for trunctated Lysostaphin with HlyA and His6-tag regulated by T7-promoter 1496
BBa_K2812006 Coding sequence for Pyocin S5 with HlyA and His6-tag 2217
BBa_K2812007 Coding sequence for Pyocin S5 with HlyA and His6-tag regulated by pBAD-ara promoter 2288
BBa_K404300 SEG-Linker 108
BBa_K404301 GSAT-Linker 108
BBa_K404303 Z-EGFR-1907_Short-Linker 192
BBa_K404304 Z-EGFR-1907_Middle-Linker 204
BBa_K404305 Z-EGFR-1907_Long-Linker 216
BBa_K404306 Z-EGFR-1907_SEG-Linker 288
BBa_K416001 (Gly4Ser)3 Flexible Peptide Linker 45
BBa_K648005 Short Fusion Protein Linker: GGSG with standard 25 prefix/suffix 12
BBa_K648006 Long 10AA Fusion Protein Linker with Standard 25 Prefix/Suffix 30
BBa_K648007 Medium 6AA Fusion Protein Linker: GGSGGS with Standard 25 Prefix/Suffix 18

CRISPR protocol

Leave a comment

sgRNA (Single guide RNA) has two parts, crRNA (20 bp CRISPR RNAs) and tracrRNA (84 bp trans-activating crRNA):

1- Go to http://chopchop.cbu.uib.no/ and design a crRNA

2- For example for AHR for Exon 1 is:

TCACCTACGCCAGTCGCAAGCGG

Change first nucleotide to G and remove CGG (PAM sequence) at the end:

  • GCACCTACGCCAGTCGCAAG

3- Put it between these arms on left and right to have this oligo:

CGAGAAAAGCCTTGTTTGCACCTACGCCAGTCGCAAGGTTTTAGAGCTAA

Then, make a reverse complement of it and put it between these arms at left and right:

CCGGTTAGCTCTAAAACCTTGCGACTGGCGTAGGTGCAAACAAGGCTTTTCTCGCATG

4- Order these two oligos and anneal them.

CGAGAAAAGCCTTGTTTGCACCTACGCCAGTCGCAAGGTTTTAGAGCTAA

CCGGTTAGCTCTAAAACCTTGCGACTGGCGTAGGTGCAAACAAGGCTTTTCTCGCATG

 

5- Annealing two ordered oligos (after annealing, the dsDNA has already cohesive ends for SphI and AgeI):

Clone the oligos: I put 1 ug of each oligo in 10 ul of 1X T4 ligase buffer (there is ATP already in this buffer so I don’t have to use the T4 PNK buffer and supplement ATP). Then, I add 3 ul of T4 PNK, incubate 30 min at 37C to kinase the oligos. Then I put the oligos at 95C for 2 minutes to denature the enzyme and any annealed oligos and I let the oligos cool down in a heating block until it reaches room temperature. Then, the oligos should be annealed.

6- Digest plasmid with SphI and AgeI. Now dephosphorylate the linearized plasmid with Antarctic Phosphatase. Deactivate it, run it on gel and extract and purify it.

CRISPR plasmid

7- Mix annealed-fragment from step 5 with linearized-plasmid from step6 and ligate them by T4-ligase.

Then I take 1 ul of the annealed oligos (200 ng total) and I mix with 200 ng of cut, dephosphorylated and gel-purified vector with 1 ul of T4 DNA ligase in 20 ul of 1X T4 DNA ligase buffer. I ligate overnight at room temperature and transform bacteria the next day. You can play with the oligos/Vector ratio if the yield is not great.

8- Transform competent bacteria.

9- Plasmid purification and sequencing for verification.

10- Transfecting HEK293 cells to verify the efficiency of gRNA to knockout the gene.

11- To verify the knockout the gene in 293 cells we use:

 

“T7 Endonuclease I cleavage assay”

The method is pretty straightforward and consists of 4 parts: DNA isolation, PCR of desired locus, denaturation and re-annealing, and T7 endonuclease I cleavage.

*****************

* DNA isolation *

*****************

Use your favorite protocol, or the quick ‘n’ dirty method below

HotSHOT lysis

  1. Trypsinize cells from a well of a 24-well or 12-well microfuge tube. Collect in an Eppendorf, spin out the supernatant. You don’t need a lot of cells, eyeball maybe 10-20 ul cell pellet at most for efficient lysis
  2. Add 75-100 µl Alkaline Lysis Reagent. Assure that the cell pellet is completely submerged.
  3. Incubate at 95°C for 30-60 min.
  4. Add 75-100 µl Neutralization Reagent using a new aerosol-barrier tip for each sample. Mix well, using tip to break up tissue. Some people like to centrifuge the tubes after this step and transfer the neutralized supernatant to a new tube, but this is not necessary.
  5. Use 2-3 µl of neutralized supernatant per 20-25 µl PCR reaction, more and you might start to inhibit the PCR reaction (usually the case for mouse.

 

Alkaline Lysis Reagent:

To 25 ml water, add:

62.5 µl of 10 N NaOH (final concentration is 25 mM.)

10.0 µl of 0.5 M disodium EDTA (final concentration is 0.2 mM, pH should be about 12 but should not have to be adjusted.)

Make fresh every one to two months. Keep solution at room temperature.

Neutralization Reagent

40 mM Tris-HCl pH should be about 5 but should not have to be adjusted.)

Keep solution at room temperature.

Make 1 M Tris-HCl with Tris hydrochloride salt (not the base).

****************

* PCR reaction *

****************

You preferably want to use a high-fidelity polymerase with hotstart characteristics. I used Q5 hotstart from NEB because it is cheap and robust. Design primers of your targeted locus using Primer-BLAST; set the desired target size to be between 200-1000 bp and 300 bp offset from the sgRNA, %GC-content 40-60%, melting temperature optimum at 60, oligo size 18-25 nt in length.

Protocol that I followed:

Component 25 µl Reaction

5X Q5 Reaction Buffer 5 µl

10 mM dNTPs 0.5 µl

10 µM Forward Primer 1.25 µl

10 µM Reverse Primer 1.25 µl

Template DNA 2 µl

Q5 Hot Start 0.25 µl

Nuclease-Free Water to 25 µl

You might need to add GC-enhancer if the region that you are PCRing up is especially GC-rich or has a GC-rich stretch of nucleotides.

Thermocycling Conditions for a Routine PCR

STEP TEMP TIME

Initial Denaturation 98°C 30 seconds

25–35 Cycles 98°C 10 seconds

*50–72°C 30 seconds

72°C 30 seconds/kb

Final Extension 72°C 2 minutes

Hold 10°C

Use the NEB calculator to calculate the annealing temperature for your oligos. If it calculates your oligos for use at 72°C, do a 2-step reaction, but extend the 72°C to 60 seconds.

I do several reactions to achieve enough substrate for the assay — 3-4 reactions generally will yield a nice quantity. You will need at least ~200 ng per reaction. Load a couple of µl from a reaction on a gel to make sure that you have a single band (also load your negative reaction to make sure that you have no contamination). I purify using a spin column and elute in 50 µl of warm (60°C) elution buffer. This will typically yield ~20-30 ng/µl of product.

****************

* Re-annealing *

****************

Add ~200-500 ng of product to a 20 µl reaction of H2O and (2 µl) 1X NEB Buffer 2. You will need 2 tubes per reaction, one for the nuclease and one for a negative (non-nuclease) control. Denature and re-anneal in a PCR machine using the parameters below:

Temperature Time

95 °C 10 min

95 °C to 85 °C (‐2.0 °C/s)

85 °C 1 min

85 °C to 75 °C (‐0.3 °C/s)

75 °C 1 min

75 °C to 65 °C (‐0.3 °C/s)

65 °C 1 min

65 °C to 55 °C (‐0.3 °C/s)

55 °C 1 min

55 °C to 45 °C (‐0.3 °C/s)

45 °C 1 min

45 °C to 35 °C (‐0.3 °C/s)

35 °C 1 min

35 °C to 25 °C (‐0.3 °C/s)

25 °C 1 min

10 °C Hold ∞

On our machine ‐2.0 °C/s is a 50% ramp rate and a ‐0.3 °C/s is a 2% ramp rate.

************************************

* T7 Endonuclease I cleavage assay *

************************************

To each tube, add 1 µl of T7 endonuclease I (10 U). Incubate at 37°C for 15 min. Stop the reaction by the adding 2 µl of 0.5 M EDTA. Load half (or more) on a 2% TBE or 1.5% SB agarose gel. Staining afterword will give a cleaner signal-noise, in which case wait until the orange dye is near the bottom of the gel (and the cyan dye is about 1/3-1/2 the way down) before you stop and stain the gel (0.5 ug/ml of EtBr for 15 min, rinse in H2O, de-stain 15 min in H2O).

Or use

“IDT Surveyor Mutation Detection Kits”

12- If we observed a mutation in step 11, we transfect new HEK293cells with packaging plasmids (psPAX2 and pMD2.G) plus the plasmid made above.

13- Transduce the target cells with the virus produced in HEK293 cells.

14- Sort the cells in 96 well plate, based on the GFP expression.

15- Grow the cells and verify the knockout in each clone by western blot and sequencing.

 

 

Older Entries